Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E375647

Search information 
Request: 375647Match: SGN-E375647
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180927Clone name: TUS-35-K5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180927 is on microarray TOM1 spot ID 1-1-4.3.17.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C35818 [cLEG-36-H21] Trace: SGN-T70915 EST: SGN-E255632 Direction: 5' Facility: TIGR
Clone: SGN-C180927 [TUS-35-K5] Trace: SGN-T1653 EST: SGN-E378201 Direction: 5' Facility: Giov. Lab
Clone: SGN-C180927 [TUS-35-K5] Trace: SGN-T187416 EST: SGN-E375648 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375647Length: 736 bp (933 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E375647 [] (trimmed) AATACACAACCTATATGTATGTATATAAGCAATTATTTGTATACATTATGGAATTTTACTGTTTTATTCAGCATATCAAAATTGACTGACCAGTT
CTGGTCCTAAGGATTTCACAACATTGCTCCCACCCAAGGAGACAAATTCATAAAAAAAAATAATTAAACAGGATGTAGTTGCAGGAGCTTCAAAG
GCACACCATCTTTTCAATTTTCTTTGCTGGCCTTGTATGCGTTAACAAGTTGCGTTTGTGTATCTCCTGAAACTGGGGCATGCTCTCTGTATTCC
ATTGTGAACTCACCTTTCCCCTGTGTCATTGATCGAAGAGATGTTGAGTACCCAAACATCATGTTGAGAGGAACATTGGCAGTAATTACAGAGTC
ATCTCCTTCCTGGTCATTGCCGATTATGACACCTTTCCTCTTATTGATATCCCCAGTAACAGTGCCCTGAAATTCTGTTGGCACTTTTATATCCA
CCAGCATCACAGGTTCTAAAATTATAGGCTTGGCTGCAGTATAACACTGTCTAAAAGCATAAATAGAAGCTAATTTGAATGCAAGTTCACTTGAA
TCAACATTATGTGAGGCACCATCCGTCAAAACAACACGGATATTTTCAACAGGATGACCAATCAGAGAGCCCGAATTGGCAGCCTCCCTGAAACC
CTTTTCAATTGCAGGGACATAGTTTGACGGAATAGTTTGTCCCACAAGCATGTTCTCAAATTCAAACTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375647] SGN-U570886 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187415 [Download][View] Facility Assigned ID: FA0AAD23AF03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5