Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E375673

Search information 
Request: 375673Match: SGN-E375673
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181031Clone name: TUS-35-O13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181031 is on microarray TOM1 spot ID 1-1-4.3.17.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C36753 [cLEG-39-O6] Trace: SGN-T71533 EST: SGN-E257847 Direction: 5' Facility: TIGR
Clone: SGN-C181031 [TUS-35-O13] Trace: SGN-T187440 EST: SGN-E375672 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375673Length: 691 bp (910 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E375673 [] (trimmed) CGCAGTGAAGGGATCCAATACAAGAAGAATGAAGTATTTTTGGATGTTGTGGAGAGTGTTAATATACTTGTTAATAGCAATGGGCAAATAGTGAG
GTCAGATGTTGTCGGTGCATTGAAGATGCGGACATACTTGAGTGGTATGCCGGAGTGTAAGCTTGGTCTGAATGATAGAGTATTGCTGGAAGCAC
AAGGACGTAATGCTAAGGGGAAGGCTATTGATCTAGATGATATCAAGTTTCATCAGTGTGTGCGTTTGGCCCGATTTGAGAATGATCGTACTATA
TCATTCATACCTCCTGATGGAGCTTTCGAAGTTATGACCTACAGACTCAGTACACAGGTAAAGCCTCTTGTGTGGGTAGAAGCCCAAGTGGAAAG
ACATTCTAAGAGCCGCGTGGAAATTCTGGTTAAAGCACGAAGCCAGTTCAAGGAGAGAAGCACTGCAACTAACGTTCAAATTGAGTTGCCCGTTC
CAACTGATGCAACTAATCCAGATGTTCGTACATCAATGGGATCATCTACTTATGCACCTGAAAAGGATGCATTGATTTGGAAGATAAAATCTTTT
CCTGGTGGTAAGGAATATATGTTGAGAGCAGAGTTTAGCCTTCCCAGCATTTCAGCAGAAGAAGCAGTTCCTGAAAGAGAATCTCCTATACGTGT
GAAATTTGAGATACCATATTTTACAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375673] SGN-U582355 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187441 [Download][View] Facility Assigned ID: FA0AAD23AH07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5