Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E375914

Search information 
Request: 375914Match: SGN-E375914
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C173344Clone name: TUS-15-O6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C173344 is on microarray TOM1 spot ID 1-1-3.3.20.16 [Order] [Tomato Microarray Database]
See unigene SGN-U579793 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C2093 [cLEC-14-M23] Trace: SGN-T26413 EST: SGN-E204797 Direction: 5' Facility: TIGR
Clone: SGN-C173344 [TUS-15-O6] Trace: SGN-T188767 EST: SGN-E375913 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375914Length: 578 bp (911 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E375914 [] (trimmed) GTGGTTGCAGCCTTCTTAATCCATCCTGCTACGGCTCATAATTTCTTCTTCCGGATTCTTTGGGCTTTTTGTGTATACATGGAGTCTATCTCAGT
GCTGCCTCAGCTTCGCTTGATGCAGAATGTCCAGATAATTGAGCCGTTCACAGCTCATTATGTGTTTGCATTGGGTGTTGCAAGATTCTTGGGCT
GTGCTCATTGGATTAATCAGGTCTATGACACTAGCGGAGCATATCTATATTTGGCTGGACGGGGTTACTTTTGGATACCGATGGTCTTTTTGGCG
GAAATTGTTCAAACGTTTATTTTGGCAGATTTCTGCTACTATTACATAAAGAGTGTCATGAGCGGTCAACTTTTGGTCCGTCTGCCGCAGCCTGT
ATAGAAGTTCAAATTACTATATCCTACAAAATGTAACATATGTTGTATTTCTTGTGTTATGGTGTGGATATAGAGCTTCTTCTACCTCGTATTTT
CTGTTTGTCATCTTCTCCTCTAGGCTCTAGTTCCTCTCTTGCCAATCGCACCTTGAACATATAAAATACATAAATAAATTAGCTAAATGCATTGC
CTCGATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375914] SGN-U579793 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T188768 [Download][View] Facility Assigned ID: FA0AAD3BH03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5