EST details — SGN-E375964

Search information 
Request: 375964Match: SGN-E375964
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182764Clone name: TUS-40-G18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182764 is on microarray TOM1 spot ID 1-1-7.3.5.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C119310 [cTOB-16-K11] Trace: SGN-T132722 EST: SGN-E319247 Direction: 5' Facility: TIGR
Clone: SGN-C182764 [TUS-40-G18] Trace: SGN-T187857 EST: SGN-E375963 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375964Length: 633 bp (903 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E375964 [] (trimmed) GGCCACCACCAAATTTAGCTCGAACTCAACTCCAACTATTATGGCTTTCTCGTCGCCGTTGTTTTCTCCGGTCAACTTCACCTTAAACCCTAATC
CCCAACTCAATCATCCAAAATGCACAAAGCCAAACAACCGCCGGAACCTCACCATCTGCGCCATCCCGCCGCTCTCCGCCGCTACCGACATCTCC
GCCGTCACCGATTCGTTGGACGGTAAGACTCTCGCCGTACTTGGAGGTAGTTCAGTGGCGGCACTTGCTGCTATTCTATCGCTCGCCGACCCCGA
GCGCCGGCGGCAACTTCAGGCGGAGGAGGTCGGAGGCGGTGATAAGGAGGTGGTGAGGGAGTATTTCAATAACAATGGATTCCAGAGGTGGAAGA
AGATATATGGTGATACGGATGATGTGAATAAAGTGCAGTTGGATATAAGATTGGGACATTCAAAAAGCTGGATGGAAGATAAAGAAGAGAGGCTT
GATCGCCACACAATTTTACTTTGCAAAGCTTATTGAAGCTGTCCCTGCTTAAGATTGAAAGGCAAGTGAGATCTCATTTGTTTGGCAATGTTTCT
TCACTGCTGGTTAGATATTAGGAAGTCCGTTGAGTGTTTATTATGAATGTGTTCTTTCACTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375964] SGN-U581974 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187858 [Download][View] Facility Assigned ID: FA0AAD28BD09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.990 Expected Error Rate: 0.0033 Quality Trim Threshold: 12.5