EST details — SGN-E376246

Search information 
Request: 376246Match: SGN-E376246
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185979Clone name: TUS-48-M17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185979 is on microarray TOM1 spot ID 1-1-8.1.7.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C73669 [cLER-5-K16] Trace: SGN-T93034 EST: SGN-E279525 Direction: 5' Facility: TIGR
Clone: SGN-C185979 [TUS-48-M17] Trace: SGN-T188285 EST: SGN-E376245 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E376246Length: 341 bp (904 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E376246 [] (trimmed) AGGTACAACTTGACAAGCCCAGATGGCCAAGATGCTTTGTGCATGGACCAAGCTTGGGTTGCCCAAGTAGTCAAGTCCACCCTCGCTGAAAATCT
GGGAACCGGCCTTGAACCACACAGCTTCACCAAATTTGACACCATTACGGGCCAAGAGCTCAGGGAAGACACATCCAAGAGCACCAAGCATAGCC
CATCTGCAGTGGATCACCTCAAGTTCACGGTTCTTGGCAAAGGTCTCAGGGTCAGCTGAAAGTCCAGCGGTATCCCATCCATAGTCACCAGGGAA
TTCGCCAGTCAAGTAGCTTGGTGACTCACCAGAGAATGGTCCCAAGTACCTGCCCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E376246] SGN-U580483 Tomato 200607 Build 2 81 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T188286 [Download][View] Facility Assigned ID: FA0AAD36AG09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0