EST details — SGN-E376249

Search information 
Request: 376249Match: SGN-E376249
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185985Clone name: TUS-48-M23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185985 is on microarray TOM1 spot ID 1-1-2.1.7.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C69498 [cLER-10-P2] Trace: SGN-T94064 EST: SGN-E278637 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E376249Length: 237 bp (882 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E376249 [] (trimmed) ATCAAAACGAATCACAAGAAATCTTATACATCCAATTATTACAAAGTGCCCAAACACAAAGTTTGAACATTATTATAATTCAATACATTAATTAA
AACAACTTAGGTCCACACTACCTAAGCAATTGAAGTGAAATTAAAATTGGCACATGTAGTTTGTCTAAAAAGGATTGAAGATGTGAATCCCACCT
CGGCCTCGAGCGGGCGACCGGGCAGGTACAAGCTTTTTTTTTTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E376249] SGN-U567907 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T188289 [Download][View] Facility Assigned ID: FA0AAD36AG12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.905 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5