EST details — SGN-E376311
Search information |
Request: 376311 | Match: SGN-E376311 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C185890 | Clone name: TUS-48-I24 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C185890 is on microarray TOM1 spot ID 1-1-1.1.7.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C16468 [cLED-16-J22] | Trace: SGN-T52507 | EST: SGN-E235934 | Direction: 5' | Facility: TIGR |
Clone: SGN-C185890 [TUS-48-I24] | Trace: SGN-T188352 | EST: SGN-E376312 | Direction: 5' | Facility: INRA |
Sequence |
Sequence Id: SGN-E376311 | Length: 59 bp (884 bp untrimmed) |
Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E376311 [] (trimmed - flagged)
CGGGCAGGTACAAGCTTTTTTTAGGCTTTTATTTTTTTTGGTTTTTTTCCTCCCATTTA
Unigenes |
Current Unigene builds | |||||
No current unigene builds incorporate this sequence |
Chromatogram |
SGN-ID: SGN-T188351 [Download][View] | Facility Assigned ID: FA0AAD36BE12FM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Problems: | Possibly chimeric (anomalous insert into vector) |
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 0 |