EST details — SGN-E376313
Search information |
Request: 376313 | Match: SGN-E376313 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C185918 | Clone name: TUS-48-K4 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C185918 is on microarray TOM1 spot ID 1-1-5.3.7.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C72380 [cLER-1-P7] | Trace: SGN-T92177 | EST: SGN-E280623 | Direction: 5' | Facility: TIGR |
Clone: SGN-C185918 [TUS-48-K4] | Trace: SGN-T188354 | EST: SGN-E376314 | Direction: 5' | Facility: INRA |
Sequence |
Sequence Id: SGN-E376313 | Length: 191 bp (908 bp untrimmed) |
Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E376313 [] (trimmed)
CGGGCAGGTACTTCTTCATGTTAATTGGTGGCCACACCTGCATGCAACTGACTCTTCCACCGTTGCTAGCAATGGAGGTAATGTCAAGGTTTTGC
TTCCTTGAAACAGGGAAAGAAGCAGTGGACTTGAGTCCAGTGAAGGGTGCAACCATGCTAGCTTGTGCACCATTGCCGCGGGTGGCAACAGCACC
T
TTCCTTGAAACAGGGAAAGAAGCAGTGGACTTGAGTCCAGTGAAGGGTGCAACCATGCTAGCTTGTGCACCATTGCCGCGGGTGGCAACAGCACC
T
Unigenes |
Current Unigene builds | |||||
[SGN-E376313] | SGN-U578438 | Tomato 200607 | Build 2 | 819 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T188353 [Download][View] | Facility Assigned ID: FA0AAD36BF02FM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 0 |