EST details — SGN-E376473

Search information 
Request: 376473Match: SGN-E376473
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174007Clone name: TUS-17-J21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174007 is on microarray TOM1 spot ID 1-1-4.2.17.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C6563 [cLEC-35-M9] Trace: SGN-T30630 EST: SGN-E210282 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E376473Length: 609 bp (895 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E376473 [] (trimmed) TGAATCAACAAAAACTCATCCTAAATCCATTATCTCCATTTTATTGCCACACAAAATCATGAAATAAGCTTAAAGGTCATGTACTCATTTTGAAG
TAGTAACACGTTGAATGTAAACTTGATAATGGGCAAGCAATTCATCTTTAGGAGGTAAATATTTCTTGTTTTGCGTACAATATTCGTCTCTCCAA
TCACAAAAATTTGGATATTTTTCTTTTGTCACCAAAACAACTCCAGATGCTTTTTCAAGAACTCCTAGCCAAAGGGCTGCAGCATTTGCAACAAT
ATCAACAAATCCAAATTTTTCACCAACAAAAATCTTCTTGTTTTTCAGCTCATTATCAAAAACTTTCAACATATCATAAACTTCCTCTTTAGCTT
TCTCTTGCTCCTCTCCTTTGAAAAATATACTTTTCCTTATTGCTAGCCCCTACACAATACATAAACATACATTAAAATTCGATCTTAATCTGTAA
GTAAGCAAGCACTTTAACTTTGAAAAATGCATATTTAGACAATTCAAGTGACCAATGTTCAATATAATTGACACAAAGTTGAAATAAGATGTCTA
GATGTGTGTACTAAGTTTATTTGTTTATTACAAGTCGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E376473] SGN-U577816 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T189087 [Download][View] Facility Assigned ID: FA0AAD5CE11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.914 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5