EST details — SGN-E376571

Search information 
Request: 376571Match: SGN-E376571
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174176Clone name: TUS-18-A22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174176 is on microarray TOM1 spot ID 1-1-3.1.16.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C7175 [cLEC-38-B18] Trace: SGN-T31584 EST: SGN-E209049 Direction: 5' Facility: TIGR
Clone: SGN-C174176 [TUS-18-A22] Trace: SGN-T189186 EST: SGN-E376572 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E376571Length: 679 bp (878 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E376571 [] (trimmed) GATTAAACTTCAGCCATTTTTTCCTTTAACTGAACAGACCAATTGGAATACAAGATATTTTGGCTATCAATTGAAAGAGTTATAAATAAGGAAAG
TTACATATTTGGTCGGCCGGCCAAAATAATTACATTCGCCTAGCCAACTATATATAAAAAAGATACACTATTTGTATATTATATGTATTTCAATA
CAATAATATACAAAAATAATACTCTAATAATATACATTTGCTATGGTCTTCAATTCATAGTTTGATTGTAGGACCATCATATGTTCCTCCTAACA
CAACAAACTGCTCATCTTTTCGTTCTTCAAGCCATGCATATGATCTTTTCTCATCTTCCTTCATCTCTTTATTAACATCGGATAAACTTATGTGA
TCATACGAGTAATGTTGATAATATGTGCAATGACGGCCTTCAGCTTCAGAGTATGGTGGTCCTAAAACATCAAGTAGGATACATGGTGTTATTGC
CTTGAAGCAATGCATGTTTCCTCCTGATTCTGGAAATAGAACTGAAGATTTGCATGGTGCAGAGAAGTCATCGTCAACATGTACTTTTGCCAGCC
TCATCCTAGATTCATGTTGCCCGCGATCGTGGTTAGCCTGGTGGTTGTGATTTTGCACCCAATCATATGACGTGGTGTGCATGGTTCCTGCTAGA
AGCTTGCAGAACAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E376571] SGN-U571592 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T189185 [Download][View] Facility Assigned ID: FA0AAD6BA11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0034 Quality Trim Threshold: 14.5