EST details — SGN-E377077

Search information 
Request: 377077Match: SGN-E377077
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175455Clone name: TUS-21-G5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175455 is on microarray TOM1 spot ID 1-1-4.3.13.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15296 [cLED-11-I17] Trace: SGN-T51288 EST: SGN-E235278 Direction: 5' Facility: TIGR
Clone: SGN-C175455 [TUS-21-G5] Trace: SGN-T1371 EST: SGN-E378514 Direction: 5' Facility: Giov. Lab
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377077Length: 644 bp (947 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E377077 [] (trimmed) CTCCACAGCCACATCCTATGTACGGACAAGCTCCCGGACTCTATCCTAGACCTGGTCAACACTCCGGCGGCCGGAACCCTCCTTTCCATCACACG
CCTCCTCCGTCTTCAAACACTGGAATCGGCATCAGAGTTGCTATTAAACCCGAATATCGGATTACACCTCCGCCTCAATTGTCAACACAAGTGGG
AGAAATTCCCCGAAGCACATTCAACTTTGATTTTGACCTTGAGAAAAAGATTTTGGCTGAAGCAGAAAAGGAAAGCCAGAACTGGAGCAAGCTAG
GGCTGGAAAATCTTCCACCTATAATGCCAGAACAACCTAGCATGGGATACACTGGAGATCTTATGATGAACAAATACGCAACAGCTGGTTTCAAT
AGAGAGGCTGTGGCCATAGCAGTTGCAAATTATGGTGATAATCCGATCAAGGTGAAGGAATTTGTGGAGGGATATACTCTCTTGAAAGAGATGGG
ATTCTCATCAAACAGTGTTGCAGATGCCTTACTGATGAATGACAACGATAAAGATAAGGCAGCAGCTCAATTGCTAGGCAATTCATCATAATAAT
TTTAATGAATATGTAACGTAATGAATGTGTCACTACATTATAATTCAAACCTTATACTTCCATTGTAAATGTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377077] SGN-U574830 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190268 [Download][View] Facility Assigned ID: FA0AAD9AD03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0037 Quality Trim Threshold: 12.5