EST details — SGN-E377079

Search information 
Request: 377079Match: SGN-E377079
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175459Clone name: TUS-21-G9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175459 is on microarray TOM1 spot ID 1-1-8.3.13.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15302 [cLED-11-I22] Trace: SGN-T51327 EST: SGN-E235317 Direction: 5' Facility: TIGR
Clone: SGN-C175459 [TUS-21-G9] Trace: SGN-T190269 EST: SGN-E377078 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377079Length: 681 bp (953 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E377079 [] (trimmed) GACTGAAGCAGATGTTGGCTTAAGACCCAATATGCCATATTTCAAGTCAACTGTATCAGATAAACCTCCTAAAATAACATACTTGCATCTCCATG
AATGTGACAAATTCTCGATTGGTATCTTTTGCTTACCACCAAAAGCAGTCATTCCTCTTCATAACCATCCTGGAATGACAGTTTTCAGCAAGCTT
CTCTTTGGGAAAATGCACATAAAATCTTATGATTGGGCGGACAATCTCCTTCCGAAATCAACTACACCAGGGGATTGTACAGGTCTGCGTCTTGC
AAAATTGAAGGTGAATTCCAAGTTTAAAGCTCCTTGCAAAACTTCAATCCTCTATCCTGCTGACGGAGGTAATATGCACTGCTTCACAGCAAAGA
CAGCTTGCGCCGTACTAGATGTTCTCGGCCCACCTTATTGTGATCCTGACGGTCGCCACTGCCAATACTACTATGACTTCCCCTTTGCCAACATG
TCAGTGAATGACTTTTTAGTACCTGAAGAAGAGCAAAGTGAGTATGCATGGCTCAAAGAGAGGGAGAAACCTGAGGACTTGACTGTAGCTGGAGC
ACTGTATAGTGGACCAAATTTAGTGTAGTAAACTCAGCTTGTGTTGAAGAAGAAGAAGAATGAGGATTTTCATTTTTTCTGCTCAACTTTTTACA
CTTTCCACTGATGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377079] SGN-U571474 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190270 [Download][View] Facility Assigned ID: FA0AAD9AD05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5