EST details — SGN-E377289

Search information 
Request: 377289Match: SGN-E377289
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174770Clone name: TUS-19-J16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174770 is on microarray TOM1 spot ID 1-1-1.2.15.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23542 [cLED-5-K8] Trace: SGN-T49812 EST: SGN-E231196 Direction: 5' Facility: TIGR
Clone: SGN-C174770 [TUS-19-J16] Trace: SGN-T189644 EST: SGN-E377290 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377289Length: 666 bp (934 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E377289 [] (trimmed) CGACTCAAAGTCAACAACTTAAATACTTCAAAACAAGAGTGCCTACAAAGGTATGAGTATTGCCAACTAAGCAGTTAACACCTAAATAGTCTTAT
TAAAATCGACCCAACAAATAGAACTATAACTAACCAACCAAACTAGAGAACATTTTCATATATTAACAGGAAACATATCATGTGAATGCACCCTT
CTAAACTGCATGGATTGGATTGGGGCTAGAGTTCATGCCTGAGCTACCAAATGACGGATTAGCATGGAAAGCTGACTGCCTGGAGGAGCCCTCGA
CCAGCTTTAGTGACAGAAAAGGGGGCTTGGCAGCATCACCAATGGACTCACCTAAGCTTAGCTTTGACATACCAACCAGCTCATCAACATTAATT
GGACTCTTTGAATGAACAGCTGTTGGCTTCAAAACTTCATGGGTCTTTGCTATTGCTGGCTCTGCAGTGTAACCTGGCCAGCATGGATAAGGCAT
CGGGTAAAATGGAGCAACATAAGCAGGATAAACAAGTGGATGCTGATATTGTGAGCTTTCTGGTATAGAAAGAGCATGTTCCCCATCGATGGAGT
TGGCAGAAGCTGCTGAACCCATTGATTCACATTCTTCATCCACAGCAGGAGTAGGAGGCAACGGATTGTTGCTTTGCATCTCAGCTTGTGCAGGA
T
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377289] SGN-U582548 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T189643 [Download][View] Facility Assigned ID: FA0AAD7DE08FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0093 Quality Trim Threshold: 14.5