EST details — SGN-E377405

Search information 
Request: 377405Match: SGN-E377405
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175410Clone name: TUS-21-E8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175410 is on microarray TOM1 spot ID 1-1-1.1.13.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15203 [cLED-11-D8] Trace: SGN-T51565 EST: SGN-E235555 Direction: 5' Facility: TIGR
Clone: SGN-C175410 [TUS-21-E8] Trace: SGN-T190456 EST: SGN-E377406 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377405Length: 676 bp (956 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E377405 [] (trimmed) GGGGGTAAAACATACATTTACAATGGAAGTATAAGGTTTGAATTATAATGTAGGGACCCATTCATTACGTTACATATTCATTAAAATTATTATGA
TGAATTGCCTAACAATTGAGCTGCTGCCTTATTTTTATCGTTGGCATTCATCAATAAGGCATTTGCAACACTGTTTGATGAAAATCCCATTTTTT
TTAAAAAAGTATATCCCTCCACAAATTCCTTCACCTTGATCGGATTATCACCATAATTTGCAACTGCTATGGCCACAGCCTTTTTATTGAAACCA
GCTGTTGCGTATTTGTTCATCATAAAATCTCCAGGGTATCCCATGCTAGGTTGTTCTGGCATTATAGGGGGAAAATTTTCCAGCCCTAGCTTGCT
CCAGTTTTGGCTTTCCTTTTTTGCTTCAGCCAAAATTTTTTTTTTAAGGTCAAAATCAAAGTTGAATGTGCTTTGGGGAATTTTTCCCACTTGTG
TTGACAATTGAGGGGGAGGGGTAATCCGATATTCGGGTTTAATAGCAACTTTTATGCCGATTCCAGTGTTTGAAAACGGAGGAGGCGTGTGATGG
AAAGGAGGGTTCCGGCCGCCGGAGTGTTGACCAGGTCTAGGATAGAGTCCGGGAGCTTGTCCGTACATAGGATGTGGCTTGGGGAGCCTGCAACC
CCGGGGGATCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377405] SGN-U574830 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190455 [Download][View] Facility Assigned ID: FA0AAD9BC04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0139 Quality Trim Threshold: 12.5