EST details — SGN-E377650

Search information 
Request: 377650Match: SGN-E377650
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175214Clone name: TUS-20-M4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175214 is on microarray TOM1 spot ID 1-1-5.1.13.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C24117 [cLED-7-E15] Trace: SGN-T50470 EST: SGN-E231961 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377650Length: 439 bp (914 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E377650 [] (trimmed) TTTTTTGGACCCCCCGGGCTGCAGGTTCAAACACAAACTCAACCCAACAAGATGCGTCTTCTTCTTTCAATAATTCAAACAACTCTCAATCTTCA
CTGTTGCAAGGATCCAATGGTATGTTGCCAGGGACAGTGCAGAACTTACCTGTCAGTGGGTTGCCAAGTACCAGTCTGCAGCAACAACAGCAGCA
ATTACTGAGTAGTGGTTTACTCTCGCAAAGTCAATCTCAATCCTCGCAGGGAAGCCAGGCGCTGCAGCAGCAAATGATCCAGCAGCTCCTCCAGG
ACATGAACACCAACAATGGTGGGTCTGGAGTTCAACAGCAGTGCCTTTCTGGACAGAGTGGAGGTGGTAGTGCTTCGAGGGAAGGGGTTGCTTTT
GGCAACAATGGGTCTGGAGTTCAACAGCAGTGCCTTTCTGGACAGAGTGGGGGAGGTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377650] SGN-U575406 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T189861 [Download][View] Facility Assigned ID: FA0AAD8BG02RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0007 Quality Trim Threshold: 14.5