EST details — SGN-E377686

Search information 
Request: 377686Match: SGN-E377686
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175020Clone name: TUS-20-E2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175020 is on microarray TOM1 spot ID 1-1-7.1.14.20 [Order] [Tomato Microarray Database]
See unigene SGN-U575308 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C23863 [cLED-6-I5] Trace: SGN-T50215 EST: SGN-E233229 Direction: 5' Facility: TIGR
Clone: SGN-C175020 [TUS-20-E2] Trace: SGN-T189898 EST: SGN-E377687 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377686Length: 522 bp (912 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E377686 [] (trimmed) AACAGCAGAACAATGAAATCTTGTTTCAATATTGTTCTAGTGCATTGGGTGACAAGCACTAAAGAAGCACTATACAGAAATCAGCAGCAACTCTG
TTATCCTCTGCTTTTGGAATCACCTATAACTATAAACTTTCAGCTGGAAATGAGGTTTTGCAAATTCACTGCGAATTTGCGCATTCCCATTGGAG
ACACTTCAAGAGATAGTGTTTTTCATTCCCTGATTGCTGAAGGATCCAATAGGTTTGGCAAGAATGTGTGACATTGCTTTGACTGAAAGAGGGTT
ATTCTCGCTGATTGAGCAGGTGCCGGCTTTAACATTGCAGACAGGATAATCATGTGGGCAGCAACTGTTATGGTCTTTACAGCAAGTAGCTCCTT
CCATAGGGCAGCAACCCCAAGCAAAGCACATGTGATAGTACTCGTAGACACAGCAACACGTTGTTCCTGATGGGCAACTGTACATATCATCACAA
GTAGTAGGTGGCTTGACTGGCGATGGAGGAGATGGAGCTGGTTTCGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377686] SGN-U575308 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T189897 [Download][View] Facility Assigned ID: FA0AAD8BC01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0024 Quality Trim Threshold: 12.5