EST details — SGN-E3777

Search information 
Request: 3777Match: SGN-E3777
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C131259Clone name: cTOD-21-L11
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C131259 [cTOD-21-L11] Trace: SGN-T146246 EST: SGN-E334197 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E3777Length: 510 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E3777 [] (called/trimmed by facility)
CCGTACTTGGTTTTGGTCGGTCATCATTTAGTGGGAAAAATTGGCTGTCATTTTTGTTGACAGATGTTTGGAACTGTACTTTTGTTTACTGGTTC
ATCATTTTTCTAGAAAGCTCGATAGTAGTATATTATTGCCTGCACTTGCCACTAAAATCTAGTTTTGGTATCTATCTTTGTTTTTGGAACTTTTG
GGATATGAATTATTATTATGCTGTTTCAGCTCTGAGTTTGTCATAGTTCCTTTGTTGTTTCATATTGCAAGAGCTTTCTGTTGAGATAGAGCTAG
TTTCACCTTTCTAACTGGTGTAGGCCTTGTAACAATCGTCTAGAATGATGGATTAACAATTTTGTCCTTTTGAGTTAATAACATTTGAATCAGCA
CAAATGATGGATTTGAATCTCCAGTTCTACAAGAAAATGCAATCCTCCCTTAGAGTGAGAAAAAGGAAATTTGTGTACACCTCTCAGTTTCGCAA
TAATTTATTTTCATAACATGTGTATATATGTGAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T146246 [Download] [View] Facility Assigned ID: TFDDE66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence