Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E377836

Search information 
Request: 377836Match: SGN-E377836
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175527Clone name: TUS-21-J5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175527 is on microarray TOM1 spot ID 1-1-4.2.13.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15421 [cLED-11-O10] Trace: SGN-T51514 EST: SGN-E235504 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E377836Length: 712 bp (928 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E377836 [] (trimmed) CAGGGTTCCATCAACCTGGGCGAAACTCAAAGGTGAAATTTGCTATTACTCATCATGGAAAGTTTAATGAAAGAGTATGCTGCTTTTGAAGAAAA
AGTAAAGCGTACTATCCTCATTGACAGCCTTTCACCTGCGGCTACTGAAGCTGTCGTTAGAGCTTCACTTGATCAATTTGGGAATGTCATTCAGG
TCAAGTTTATCCCAAACTACCTTGAACCAAAGACCGTTGGACTATCTGCATTGGTTGAGCTGGAAAATGCAGACCAGGCGAAAACTATAATCTCC
GAGATAAGCAGTTCCTCATTTATGATCTGTGGCATGCCAAGGCCTGTCAGGGCACGTGCTGCTGAAGTAGAGATGTTCGATGACCGTCCTATAAA
ACCTGGTAGGAAGATAGTATGCCGATGGTTGGACTCCAGTGATCCTGATTTTGAGGTCACTGAGAAGATCAAGCATTTGGTTAGCAAACATGCAG
AAGAAGCCAAGTTTTGCCTCAAGCATCAACTAGAGGAGGAGGAGAATCTTGCGAAAAAACAGACAGAGATCTTGAACGCAGCGTATAAGAAGTAT
GAACTCATAGACAGTGTTGTTGGCAACAGAGTCGCTGAACGTCTGTCTGAACGTTACAGAGTGCACGTTTGCAAATGCTGAACAGCACTAAACTC
GTCTGTTCAACGCCTATGCAAAAAAACTTACATAGACCTAATGATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E377836] SGN-U574858 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190598 [Download][View] Facility Assigned ID: FA0AAD9CE03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0023 Quality Trim Threshold: 14.5