EST details — SGN-E378019

Search information 
Request: 378019Match: SGN-E378019
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174948Clone name: TUS-20-B2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174948 is on microarray TOM1 spot ID 1-1-7.2.14.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23782 [cLED-6-F18] Trace: SGN-T50188 EST: SGN-E233202 Direction: 5' Facility: TIGR
Clone: SGN-C174948 [TUS-20-B2] Trace: SGN-T190165 EST: SGN-E377943 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378019Length: 710 bp (930 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E378019 [] (trimmed) TGNTTTTTGCAAACATATTTTAAACTATAAATTTCTAAAAGTTAGAACTGATAAAAGATTTTTATATCAATATAATCGAATGGCAAACTGCGGTA
AATACAATAGCATGGTCTGGTATTTTTCATTCCTACATTGTAAAATACTAATTACTCGGAGCTATTTTATTTATATTAAAAAAAGGTGGTAACTA
CATGTCCCAAACTAGGGACTACCACTATTTTTTTTTTTTGAAAAAAAATTATCAAACTTGATCACTTGTTAATCTCTTCTTGCACCTTCTCAATG
AAACTAAGCACACTCTCTAATCCTTTCTCATCGAATCTTGGTATAGTGTGACCCCTAGGATGATGAATCACCACTGGATCAACACATGATTCCAA
CAGTTCTATCCCATACTGTTTTAGGTAATCTTGCTCACCTAAAAAATGAACGGAAGGGCATGCAATTGCTGGTGAATAAGCTTTTTCGGCCACTG
ATTTATTCCGAAATTTAGCACCTCCAATTATGATCAGATATTTAATTTTTGATGCCTTTGTAAGTCCCACTTCCTTAGCCTGCAACCCCGACAAT
GCTCCGGAAAGAATTGCCCCCTGAGAGAAACCAAGAAGACCATCGAAGGTCCATGTTTGATCATACATTCTTCTATGTATTCAAGACATTTATCA
AAATTCTCATACTCTGTAAATTCCTTATTGAATTGAAACCACCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378019] SGN-U564822 Tomato 200607 Build 2 42 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190241 [Download][View] Facility Assigned ID: FA0AAD8DA01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0081 Quality Trim Threshold: 12.5