Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E378083

Search information 
Request: 378083Match: SGN-E378083
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175338Clone name: TUS-21-B8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175338 is on microarray TOM1 spot ID 1-1-1.2.13.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378083Length: 605 bp (936 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378083 [] (trimmed) GAGACTCAAGAAATGTTGGACTTTGCGGCAAAGCATAACATAACACCAGATATTGAAGTGGTGCCAATGGAGTACGTTAACACCGCGTTGGAACG
TCTTTTGAAATCGGACGTGAAATATCGTTTTGTGCTAGACATTGGTAATACATTGAACAAGAAATGAGAATAGGGAGGGGATCAATTATGTAGCT
AGCAGTGTTTCCTCCATCATCTATTTATACTGCAGTAACTGAGATTTAGTGAATACCTTACAGAATAACAACCCTTTGCCTTTACTCTATTAACT
AAGTGAAATTCGTATATCTTTGATACATCTTTTCACATGAAAATTATACAACAAAGTCAAATTCTGAACTTAATACTCAAGAAGACAGCTTGCAC
TAATGAATTATGACGGAACACCAAGATATGATGCAAGTTGCAAGATGACACTGTACTTTTTTCTCAAAAAAATGACACAGAGTACTCCACAAGCT
GTCACTTTGATTTTAAAAAATACATCTATTTCTTTTCTTTCCAACTTGGTTATCTTATAAAATGTTGTTTTGCAAGTAAAATGATGAACATCAGT
TTCTGATGGATAGCATAAGAGAGTAAGTTCTTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378083] SGN-U572059 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190697 [Download][View] Facility Assigned ID: FA0AAD9DA04RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0117 Quality Trim Threshold: 12.5