EST details — SGN-E378126

Search information 
Request: 378126Match: SGN-E378126
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175576Clone name: TUS-21-L6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175576 is on microarray TOM1 spot ID 1-1-3.4.13.12 [Order] [Tomato Microarray Database]
See unigene SGN-U582213 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C15514 [cLED-13-C22] Trace: SGN-T51651 EST: SGN-E236373 Direction: 5' Facility: TIGR
Clone: SGN-C175576 [TUS-21-L6] Trace: SGN-T190741 EST: SGN-E378127 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378126Length: 547 bp (929 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E378126 [] (trimmed) GAATACAATTTTGACTTGAGAAGGCGTATGTTTGGAGATAATGCCCTTGGAGCTATGAATATAGAGATGGTTGAAATCGCTCGAAAGGTAGGTGC
TGCTTCCAAGTTCACAGGAAGTGGTGGGGCTGTGGTTGTGTACTGTCCGGATGGAACTTCACAAGTGAAGCAGCTGGAGGACGCATGCCACAAAG
CTGGTTTCACTTTTCAACCAATTAAAGTTATGCCTTCGTTTCTAAACGAAACTGATCTTCAAACTCTGAAATCAAAGTGAAAATGATGATCTGCT
TTCAAATATGTCGAGAGTCCTCTTTATTCTTTATTTCTTTCACCTTTCATTGGCATATGCTAAGCGCTTTTCACCAAGTATGTAGCGACCATTGA
AAGAAATGCTAGTATAGATAGTTTTAGTTACAATTGTTTTGCTGCTATTGTAATGCATTTCGAGAAGCGCTTACTTTACAGTTTTAGCGTAAACC
GTCATTAGATTCACATATTTTAACTCCAATTGTGTGATGCCAATTATAATTACTACTAAATCTGTTACTTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378126] SGN-U582213 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190740 [Download][View] Facility Assigned ID: FA0AAD9DF03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0022 Quality Trim Threshold: 12.5