EST details — SGN-E378131

Search information 
Request: 378131Match: SGN-E378131
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175590Clone name: TUS-21-L20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175590 is on microarray TOM1 spot ID 1-1-5.4.13.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15549 [cLED-13-E13] Trace: SGN-T51617 EST: SGN-E236339 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378131Length: 331 bp (920 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378131 [] (trimmed) GGGATACCATTCATATGATTTAATTTATGCAGATAGGGAACACCTTGAGTTCGTCATAAAGACAGATTATTAAACGATAGAAAACCAATGGAAGA
TCATCTCTAAGGAGCATGCAAAAAGATTTATAGAATTCCGAGAGAGGAGAGGCCTCATTGAAAAAGATGTGGTGAGGACTGATAAGTTAGATTCA
TTCTATGAAGAGGATGACAACCCAAACATTAATTGTTTGCGTGATATACTGCTGACATACTCATTCTACAACTTTGATTTGGGTTACTGTCAGGG
TATGAGCGATCTTCTTTCACCAATATTTGTTTATTATGGGAGATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378131] SGN-U596860 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T190745 [Download][View] Facility Assigned ID: FA0AAD9DF10RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0325 Quality Trim Threshold: 14.5