Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E378156

Search information 
Request: 378156Match: SGN-E378156
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174005Clone name: TUS-17-J19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174005 is on microarray TOM1 spot ID 1-1-6.2.17.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C6557 [cLEC-35-M3] Trace: SGN-T30627 EST: SGN-E210279 Direction: 5' Facility: TIGR
Clone: SGN-C174005 [TUS-17-J19] Trace: SGN-T189157 EST: SGN-E376543 Direction: 3' Facility: INRA
Clone: SGN-C174005 [TUS-17-J19] Trace: SGN-T189158 EST: SGN-E376544 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378156Length: 846 bp (1098 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378156 [] (trimmed) TTAGTTACCCCTCATCTCATTTCCCTTTCCTTCTTCTTTCGATTTATTGCTGCAAAAGCGTTTGTATTGCAGAGTTAGGGTTTCACATATAACTG
TGTGTGTACTCGCCGATTTTGGTTAGTTAGCAGAGCGAACACACCTCAAGTACAAAAAGGGTATCTGGAGTGCATACGACACGATTACTGGAAAT
AAATGGAAGCTCTACTTGTAAGAAAACTGGGCGACCCAACTCTGCCACCAAATGCCTCAGAGAAGTCGTCACTCGATCTCTCAACATCCCACCCT
ATACCTAATTTGGAATCGCCAACCTCCGTTAGAGTTCGAATCAAAGCCACCAGCTTGAATTTCGCAAATTATCTCCAAGTTCTTGGCAAATACCA
AGAGAAACCTCCGTTACCCTTCATCCCTGGCTCCGATTACTCTGGCGTTGTTGAAGCCGTTGGCCCTAATGTCACTAAGTTCAAAATTGGAGACC
TCGTTTGCTCTTTTGTTGCCCTTGGCTCATTCGCTCAATTCATCGTCGCCGATGAATCTGACTTGTTTCAAGTACCTGATGGGTGTGATCTAGTT
GCAGCTGGTGCACTTCCTGTTGCATATGGGACATCACATGTGGCACTGGTGCATAGAGCGCAGCTGCGTCCCAAACAGGTTTTACTAGTGCTTGG
AGCAGCTGGAGGCGTTGGGCTTTCGGCGGTACAAATTGGGAAGGTTTGTGGAGCGACAGTTATTGCAGTGGCTAGGGGTAATGAAAGGTGCAGTT
TTTGAAGTCTTTAGGTGTTGATCATGCAGTAGACTTGAGCAGTGCNAATGTCATCGAAAGTGTAAAGGGCTTCCTGAAGTCAAGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378156] SGN-U577157 Tomato 200607 Build 2 36 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1300 [Download] [View] Facility Assigned ID: TUS17J19.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.989 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5