Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E378201

Search information 
Request: 378201Match: SGN-E378201
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180927Clone name: TUS-35-K5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180927 is on microarray TOM1 spot ID 1-1-4.3.17.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C35818 [cLEG-36-H21] Trace: SGN-T70915 EST: SGN-E255632 Direction: 5' Facility: TIGR
Clone: SGN-C180927 [TUS-35-K5] Trace: SGN-T187415 EST: SGN-E375647 Direction: 3' Facility: INRA
Clone: SGN-C180927 [TUS-35-K5] Trace: SGN-T187416 EST: SGN-E375648 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378201Length: 935 bp (1126 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378201 [] (trimmed) TCTGGTGGACAATTTTCAAAAGCTTTGAATCGTTTTCAGAAGGAGGACCCTACATTCCGTGTGGGTTTAGATGCTGAGAGTGGTGAGACAATCAT
ATCTGGCATGGGGGAGCTGCATCTGGACATATATGTTGAGCGCATCCGGAGAGAATATAAGGTTGAAGCTCAGGTTGGAAAGCCTCGTGTAAACT
TCAGGGAAACCATCACTAAGCGAGCAGATTTTGATTATCTACACAAGAAGCAAAGTGGTGGGCAAGGTCAATATGGTAGAGTAATTGGGTATGTT
GAACCTCTTGAACCAGGGTCAGGCAGTAAGTTTGAATTTGAGAACATGCTTGTGGGACAAACTATTCCGTCAAACTATGTCCCTGCAATTGAAAA
GGGTTTCAGGGAGGCTGCCAATTCGGGCTCTCTGATTGGTCATCCTGTTGAAAATATCCGTGTTGTTTTGACGGATGGTGCCTCACATAATGTTG
ATTCAAGTGAACTTGCATTCAAATTAGCTTCTATTTATGCTTTTAGACAGTGTTATACTGCAGCCAAGCCTATAATTTTAGAACCTGTGATGCTG
GTGGATATAAAAGTGCCAACAGAATTTCAGGGCACTGTTACTGGGGATATCAATAAGAGGAAAGGTGTCATAATCGGCAATGACCAGGAAGGAGA
TGACTCTGTAATTACTGCCAATGTTCCTCTCAACATGATGTTTGGGTACTCAACATCTCTTNCGATCATGACACAGGGGAAAGGTGAGTTCACAA
TGGAATACAGAGAGCATGCCCCAGTTTCAGGAGATACACAAACGCAACTTGTTAACGCATACAGGGCCAGCAAAAAAATTGAAAAGATGGTGTGG
CTTTGAAGCTCCCTGCACTACATCCTGTTTAAATTATTTTTTTTATGAATTTGTCTCCTTGGGTGGGAGCAATGTTGTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378201] SGN-U570886 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1653 [Download] [View] Facility Assigned ID: TUS35K5.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0095 Quality Trim Threshold: 14.5