EST details — SGN-E378214

Search information 
Request: 378214Match: SGN-E378214
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182499Clone name: TUS-39-L17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182499 is on microarray TOM1 spot ID 1-1-8.4.7.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C65340 [cLEM-9-A3] Trace: SGN-T85672 EST: SGN-E268667 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378214Length: 549 bp (1120 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378214 [] (trimmed) TAATCACGTTGGTTCCTATGAAATGGTTCATCTATTTCCCATTATATATAGGCTACTTATTTCCTCACCTATAAAGTAAAAAACTTTCTAGTGTT
TTCTTCTTTCTTTTGTTTTTTTCTCTTTGCTCATATTCTAAAAATATTTCATCAATGGCATCTATCAAATCAGTTAAAGTTCCTACTATAGATTT
TTCCAATTATCAAGAGCTAAAACCAAACACTCCACTATGGGAATCCACAAAAATTCAAGTTTTTGAAGCTTTACAAGAATATGGTTGTTTTGAAG
CAATATATGATAAAGTTTCAAAGGAAATTAGAGAGGAAACATTTGATATGTCAAAAGAAATATTTGAATTTCCTTTAGAGACTAAAGTGAAAAAT
ATCTCAGAAAAACCAATGCATGGCTATATGGGGATGATTCCACAATTGCCATTGTATGAGAGTTTGTGTATTCCTGATTTGCTTAATCCCTCAAG
TCTTGAAAAATTTCTAATATCTTTTGGCCTCAGGGTAATCACATTTCTGCAATTTGATAAATATTATTCTAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378214] SGN-U579305 Tomato 200607 Build 2 261 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1728 [Download] [View] Facility Assigned ID: TUS39L17.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.920 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5