Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E378215

Search information 
Request: 378215Match: SGN-E378215
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182541Clone name: TUS-39-N11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182541 is on microarray TOM1 spot ID 1-1-6.2.8.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C70830 [cLER-16-A20] Trace: SGN-T95478 EST: SGN-E284205 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378215Length: 558 bp (1154 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378215 [] (trimmed) AAGAAACATCTTGCATGTTAAGTGTCAATTCATCTTCTTTTTCAATCAAATCATCAATTTTTCCAAAATCCATCTCTTTCTCCTCTAGCCATATT
AATAATTTCAAGAACCCTTTTTTGAACTCTAAAACTCCAATGGAAAATCAGAGTTTTTCAATGTTATCTGCTTCTAAACCTCAAAATGGAGCTGT
AATTCAAGATTCTTCTTTTCAGGGAAGTGAATCATTCTTCAGGAGTGTGTTGGGGAACATGGAAGCCATATATCTGAATAAAAACCCCACTGCTA
AGGCTATTTTGGAGCTCGTTCGTTCTGCTGATGATGATCAAATTTGCTATGATCATTTTGCATTTAGGACATTTGGGGTAAATGGTCATGGCATT
GATTCTATGTCAAAGTTCTTCTTAGATTTTGGTTACGAACGACGAGAGGAGCTGAGATTTCCTGCTAAGAAAGTGAAAGCTTTCTGGTTTTCTCC
TCCGAAGGTATCAACTTCCAGTCGTGGGAGTGGGGGTTCACGGGCCATTGCCAGAATATTTATACCCAAACTTCTTGTTGATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378215] SGN-U578798 Tomato 200607 Build 2 48 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1729 [Download] [View] Facility Assigned ID: TUS39N11.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5