EST details — SGN-E378227

Search information 
Request: 378227Match: SGN-E378227
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184537Clone name: TUS-45-A15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184537 is on microarray TOM1 spot ID 1-1-2.1.14.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C84916 [cLET-2-L10] Trace: SGN-T102800 EST: SGN-E291259 Direction: 5' Facility: TIGR
Clone: SGN-C184537 [TUS-45-A15] Trace: SGN-T198453 EST: SGN-E397127 Direction: 5' Facility: INRA
Clone: SGN-C184537 [TUS-45-A15] Trace: SGN-T198544 EST: SGN-E397218 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378227Length: 243 bp (1217 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378227 [] (trimmed) CCATTTTTGGGACAGACCAAATATGCTAACCCCCTAAGGGATATAGTTCCTATGGGCTCTGCCAGATTCACCATGAGTAATGATTTGTGGTATGG
ACCTGACCGTGTCAAGTACTTGGGACCATTTTCTGCTCAACTCCTTCATACTTGACTGGACAATTCCCTGGTGATTACGGATGGGATACTGCTGG
TTTATCTGCTGATCCCGAGGCCTTTGCTAAGACAGAGCTCTTGAGGTATCCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378227] SGN-U579843 Tomato 200607 Build 2 157 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1829 [Download] [View] Facility Assigned ID: TUS45A15.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0107 Quality Trim Threshold: 20.5