EST details — SGN-E378229

Search information 
Request: 378229Match: SGN-E378229
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184688Clone name: TUS-45-G22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184688 is on microarray TOM1 spot ID 1-1-3.3.14.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C83675 [cLET-25-K21] Trace: SGN-T108350 EST: SGN-E295625 Direction: 5' Facility: TIGR
Clone: SGN-C184688 [TUS-45-G22] Trace: SGN-T196557 EST: SGN-E395231 Direction: 5' Facility: INRA
Clone: SGN-C184688 [TUS-45-G22] Trace: SGN-T198622 EST: SGN-E397296 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378229Length: 265 bp (1068 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378229 [] (trimmed) AAAAAAAAAGGAAGCTCATTGAGAAATGTCAACTGCTTCCATTAACAATTGCCTTACTCTCTCCCCTGCTCAAGCTTCCCTTAAGAAACCTACTC
GTCCCGTTGCCTTCGCAAGGCTTGGCAACTCTTCTTCTTCTTCTTCTATTCCAAGTCTCATCAGAAACGAGCCCGTCTTTGCTGCCCCTACTNCC
ATCATCAACCCATTGTGAGAGAAAAATGGCAAAAGAATCTACGATCAAGCATTGCTGCACTCGAAAAACTCTCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378229] SGN-U578484 Tomato 200607 Build 2 220 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1844 [Download] [View] Facility Assigned ID: TUS45G22.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0177 Quality Trim Threshold: 20.5