EST details — SGN-E378277

Search information 
Request: 378277Match: SGN-E378277
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177843Clone name: TUS-27-J17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177843 is on microarray TOM1 spot ID 1-1-8.2.6.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C64114 [cLEM-5-C24] Trace: SGN-T85021 EST: SGN-E271216 Direction: 5' Facility: TIGR
Clone: SGN-C177843 [TUS-27-J17] Trace: SGN-T183091 EST: SGN-E370854 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378277Length: 933 bp (1305 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378277 [] (trimmed) GCTGGATCATTTAGTTCAGAGGACCGATATTGACACATCAAGAATAGTAGTCTTTGGAAGGTCACTTGGAGGAGCTGTTGGCACTGTTCTTACCA
AAAACAATCCTGACAAGGTAGCTGGGCTCATTTTGGAGAATACTTTCACCTCTATCCTGGATATGGCAGGAGTTCTCTTGCCATTCTTGAAGTGG
GTCATTGGTGGCAGTGGCTCAAAGGGTTTCAAGCTTCTTAACTTTGTTGTTCGATCTCCATGGAATACCATTGATGTCATTGGTGAGATCAGGCA
ACCAATCCTCTTCCTATCTGGATTACAAGATGAGATGGTTCCACCATTCCACATGCAGATGCTGTATGCAAAGGCAGCGGCACGTAACAGGCAAT
GCTTATTTGTGGAATTTCCTAGTGGGATGCACATGGATACCTGGTTGGCAGGTGGTGATCATTATTGGAGGACAATTCAGAAATATTTGGAAGAA
ACTGTCCCAGAGAAGAAGGATGATGAATCAAAGAAGGATTCCGAACTGTCCTCTAAGCAAAATGTATCTTCAGATTTCGCTGCAAGCTGAAATGT
TGAGTTTCAGGCAGTTCAAATGTAACTTTGGATTCGAGGATTCAAATACATTTCTTTTGATGTTGCAGTGATGAAGAGCAGTTTGTGATATCAAG
GGAATGGAAGTGCATCCTTTCAAATATTTATTCTTCTGATGATATTTTTTGGTGTCCTATTTTCAGAAGGTAAAAAGATGTGAAGGGTCTTGATT
TATACTGCATCTCACTAACAATACTAGGGTGTCGAAATATAGGTCCAGCTGAGTTGTTTTGTATGAATAAGGATCCAAACGTAAAATGGCAACTC
TCTACTAGAGAGTGATAACAGGCGGAAGACATTCTTTCGTGTGAATGGCTTACTCTTTATTTGGTGTGATGCTTTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378277] SGN-U572689 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1471 [Download] [View] Facility Assigned ID: TUS27J17.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0107 Quality Trim Threshold: 14.5