EST details — SGN-E378289

Search information 
Request: 378289Match: SGN-E378289
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179531Clone name: TUS-32-A1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179531 is on microarray TOM1 spot ID 1-1-8.1.1.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82358 [cLET-1-L12] Trace: SGN-T102720 EST: SGN-E292446 Direction: 5' Facility: TIGR
Clone: SGN-C179531 [TUS-32-A1] Trace: SGN-T185705 EST: SGN-E373042 Direction: 5' Facility: INRA
Clone: SGN-C179531 [TUS-32-A1] Trace: SGN-T185791 EST: SGN-E373128 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378289Length: 476 bp (1218 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378289 [] (trimmed) GACTCTCTCCAGATCGAGCAAAAATCAAAGGGGATGGCGCCGCCGAACACAGGATTAGCAGTGGGATTGAACAAAGGACACATTGTAACCAAGAA
GGAGTTAGCTCCACGCCCTTCTGACAGAAAAGGGAAAACCAGCAAAAGAATCCACTTCGTCAGGAGCCTCATCAGAGAAGTTGCTGGATTTGCTC
CATATGAGAAGAGGATTACTGAGCTTCTTAAAGTTGGTAAGGACAAGCGTGCATTGAAGGTAGCCAAGAGGAAGTTGGGTACCCACAAGAGGGCA
AAGAAGAAGAGAGAGGAGATGTCCAGCGTTCTCCGTAAGATGAGGGCAACCGGTGGTGGTGAAAAGAAGAAGTGAAGTCTCTATCCTTATTTTGA
CAATTGAGGAACTGAGTTTATTAGTTAATACATGATCTTTTTGAGTTAGCTATAAAATTCTCTAAACTTTGACACAATTATGGCTTTGAAATTTT
C
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378289] SGN-U580851 Tomato 200607 Build 2 70 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1535 [Download] [View] Facility Assigned ID: TUS32A1.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0087 Quality Trim Threshold: 12.5