EST details — SGN-E378440

Search information 
Request: 378440Match: SGN-E378440
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182051Clone name: TUS-38-J1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182051 is on microarray TOM1 spot ID 1-1-8.2.10.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182051 [TUS-38-J1] Trace: SGN-T194463 EST: SGN-E393137 Direction: 5' Facility: INRA
Clone: SGN-C182051 [TUS-38-J1] Trace: SGN-T194710 EST: SGN-E393384 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378440Length: 423 bp (1179 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378440 [] (trimmed) AACTATAAAGAGAGTAAAGCAATACCTAAAATCGAAAGATACATCCTTTTATTTTCATTGATCTTCAAGTCATAAAAAGAAGAAAAAGATCATTT
TGTTCCTAGATATCGATCGATCGTGTAGGTAGAATGGGAAGGCCACCTTGCTGCGATAAAATAGGGGTGAAAAAAGGACCATGGACACCAGAAGA
AGATATCATCTTGGTTTCATACATTCAACAACATGGTCCTGGTAACTGGAGAGCTGTTCCCAGTAATACTGGTTTGCTTAGATGCAGCAAAAGCT
GTAGGCTCAGATGGACTAATTATCTCCGGCCCCGGAATTAAACGTGGAAACTTCACTGAACATGAAGAAAAAATGATTATCCATCTTCAAGCTCT
TCTAGGCAACAGATGGGCTGCGATTGCTTTCGTATCTCCCACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378440] SGN-U570718 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1700 [Download] [View] Facility Assigned ID: TUS38J1.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0088 Quality Trim Threshold: 14.5