EST details — SGN-E378484

Search information 
Request: 378484Match: SGN-E378484
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185748Clone name: TUS-48-D2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185748 is on microarray TOM1 spot ID 1-1-7.4.7.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185748 [TUS-48-D2] Trace: SGN-T192727 EST: SGN-E391401 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378484Length: 316 bp (1002 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378484 [] (trimmed) CGNCGGCACCGTTGCTAGCAATGGAGGTAATGTCAGTTGCATGCAGGTGTGGCCACCAATTAACATGAAGAAGTACGAGACTCTGTCGTACCTTC
CTGATTTGTCCGACGAGCAATTGCTCAGCGAAATTGAGTACCTATTGAAAAATGGATGGGTTCCTTGCTTGGAATTCGAGACTGAGCACGGATTT
GTGTACCGTGAGAACCATAAGTCACCAGGATACTACGATGGCAGATACTGGACCATGTGGAAGTTGCCCATGTTTGGGTGCACTGATGCACCCCA
GGTCTTGGCTGAGGTGCAGGAGGCAAAGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378484] SGN-U578438 Tomato 200607 Build 2 819 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1900 [Download] [View] Facility Assigned ID: TUS48D2.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0068 Quality Trim Threshold: 12.5