EST details — SGN-E378498

Search information 
Request: 378498Match: SGN-E378498
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C173622Clone name: TUS-16-J20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C173622 is on microarray TOM1 spot ID 1-1-5.2.18.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C4004 [cLEC-23-E13] Trace: SGN-T28238 EST: SGN-E206279 Direction: 5' Facility: TIGR
Clone: SGN-C173622 [TUS-16-J20] Trace: SGN-T196946 EST: SGN-E395620 Direction: 3' Facility: INRA
Clone: SGN-C173622 [TUS-16-J20] Trace: SGN-T196947 EST: SGN-E395621 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378498Length: 535 bp (1173 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378498 [] (trimmed) TTCAGTTAGGGTTACAACTTTGGACTTCTTCTTGTCAAAGGACTTCCGAAAAATGGAAAGGATAATGTGAGCTCCGGTTAATCGCAGTATATTTC
TTCAACAAGATCCGGTCTTCTTCTTCTTCATAGTGAGGCAGTCTTCTTCTTCTGTTTGACAAGTATTTTTCTTCATCTCCATTGGTCTTAGTCTC
CAACAGTAATCTTCTTCTACCGCAATTTTTTATAAAGTTTTTTCTCAGATTGGAGACTCTTTTTCCTTCCAAAGCTCATCAAAACTAGCTCGTGG
TCGTTGAAGCTTGTGGCCAGCTCGTGCTCGTCCCAGTATGGCTGCTCCAAAGAAGGTTTGGGGCTTATTCTAAGTAGAATTTAAAGTTTATTCTC
TTGTCAATTAAATTTGTTGGCCTGGCTACATGTTTCCAGCAGGATTTGAATAGTCATGAGTCAACAAGAGCCTTCGAAAAGATACAAAAGAGCAA
AAAAGAACCTTGCTTTACGTGGATCATTATCATTCTGGGCAAATAAAAAACAACGATTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378498] SGN-U564002 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1286 [Download] [View] Facility Assigned ID: TUS16J20.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0103 Quality Trim Threshold: 14.5