EST details — SGN-E378500

Search information 
Request: 378500Match: SGN-E378500
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C173717Clone name: TUS-16-N19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C173717 is on microarray TOM1 spot ID 1-1-6.2.18.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C5032 [cLEC-30-F22] Trace: SGN-T29236 EST: SGN-E207240 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378500Length: 1077 bp (untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378500 [] (untrimmed)
NGCTAGTNATGCTTTACGCCTTTTGNGCGCCGAATTACAGCCCTTTGGGGGGCTATTTCCGCCGCAGAGGGGGNCNNATTACANCCGGTTTTTCC
GGGGGTTAGGGGGAAAAAGGGGGGGGGGTGCAAGAAGGGGGGTGGGGGGGTCGCGCACACCTCATGGTGGTGTGTGTTTGCCCCGGGTTGGTGGC
GGCGGGGGTGTCTCGCGCTTCCCTTCCTCGTACCGGTCGGGGGGGGGGGGGGGGGGATCGATATTACTATAATCCATCTATGGGTTGTGGTTCCG
GGTGGTTTGAGTGCGGGTCAGTTGTCTGAGGTCGGTGGGGGGGGTTGCGCGGCGTGGTTGGTTCGGCGGTTGGGGGCGTGGGTCTCTGGTGTGGT
GTGCCTGTGTTGTTCGGGGGGGGGCGGGCCGCCGGGGGCCGGGGGGTCGTGCGGCGGGGCCGGGCGCGGGTGGCTATGTGCGTTTGTTGGTCGTG
GCTATTGGGGTGTCGTGGTTGGTGGCGCGTGGGCGATGTTGGTGGTGGGCGGTGGGCGTGGCCCGGGGGTTAGTTTTTTGTTTGTTTCCTTGGTG
GGGGGGGGGGGGGCCGCACCCTCCGCGATCTGCGGGCTTTTTTTAGTGGCCGGGCTCGCGGCGCTGCCGGCGCCTGGGCGGGGCCTGCTGCTCAG
ACTTGGTGGTAGTGCGTGGGTGCGGTTGGTCGCGCGGGTCTATCGTGTAGTGCGGCGCGGGGCGGCAGAGGTGTGCACCTGTATCTGGTGGGGGG
GATGCCTGGTGCGTCAGGTGGATACTTGTCTGCTTTGTTGTATTTGTGACAGTGTTACGTAAGTTGGGGACGAGGTGCGTCTGCTGGGTGTAGGG
ATGGGTCCTTAGTGGCTGTGCTGGTGTGCGGGGCGGGGTCTCGGATGTCTGTGCGTAGCGCTGGATCGTGTGTGTGTAGGAGTGGTGGGGCGCCC
CGGGCTCGCGCGGGGCCGTGGCCTTGGGGTCGTGGCGTCGCGGGGGGTGTGCCGGGCGTGTATCTTTATTCTCTAATGTGATGGTCTGGGGTGGG
TGAGTGTGTTTGTGTCGGTGTGACGTCTGCGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T1291 [Download] [View] Facility Assigned ID: TUS16N19.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Problems: High expected error (low overall quality)
Sequence Entropy: 0.000 Expected Error Rate: 0.0058 Quality Trim Threshold: 20.5