EST details — SGN-E378514

Search information 
Request: 378514Match: SGN-E378514
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175455Clone name: TUS-21-G5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175455 is on microarray TOM1 spot ID 1-1-4.3.13.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15296 [cLED-11-I17] Trace: SGN-T51288 EST: SGN-E235278 Direction: 5' Facility: TIGR
Clone: SGN-C175455 [TUS-21-G5] Trace: SGN-T190268 EST: SGN-E377077 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378514Length: 561 bp (1277 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378514 [] (trimmed) TCCTTATGCTCCACAGAAACATCCTATGTACGGACAAGCTCCCGGATTCTATCCTAGACCTGGTCAACACTCCGGCGGCCGGAACCCTCCTTTCC
ATCACACGCCTCCTCCGTCTTCAAACACTGGAATCGGCATCAGAGTTGCTATTAAACCCGAATATCGGATTACACCTCCGCCTCAATTGTCAACA
CAAGTGGGAGAAATTCCCCGAAGCACATTCAACTTTGATTTTGACCTTGAGAAAAAGATTTTGGCTGAAGCAGAAAAGGAAAGCCAGAACTGGAG
CAAGCTAGGGCTGGAAAATCTTCCACCTATAATGCCAGAACAACCTAGCATGGGATACACTGGAGATCTTATGATGAACAAATACGCAACAGCTG
GTTTCAATAGAGAGGCTGTGGCCATAGCAGTTGCAAATTATGGTGATAATCCGATCAAGGTGAAGGAATTTGTGGAGGGATATACTCTCTTGAAA
GAGATGGGATTCTCATCAAACAGTGTTGCAGATGCCTTACTGATGAATGAACACGATAAAGATAGGGCGGCAGCTCAATTGCTAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378514] SGN-U574830 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1371 [Download] [View] Facility Assigned ID: TUS21G5.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5