Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E378523

Search information 
Request: 378523Match: SGN-E378523
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C176394Clone name: TUS-23-N8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C176394 is on microarray TOM1 spot ID 1-1-1.2.11.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C26651 [cLEF-41-C24] Trace: SGN-T60410 EST: SGN-E246995 Direction: 5' Facility: TIGR
Clone: SGN-C176394 [TUS-23-N8] Trace: SGN-T181464 EST: SGN-E368537 Direction: 3' Facility: INRA
Clone: SGN-C176394 [TUS-23-N8] Trace: SGN-T181465 EST: SGN-E368538 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378523Length: 629 bp (1305 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378523 [] (trimmed) ACAAGTCCAAGCGTATATTATATTTGTGATTGAGCTAACAGATCCCACCATACCATTGGTGATTGCTTGCGAGTAGAGTAATTGGTTGTTGAAGG
AGAAATGGCCAGGAGAGCAGACGAAGAGTACGATTACTTGTTCAAAATTGTGTTAATCGTGAATTCTGGAGTTGGAAAATCCCCTTTACTCTCCA
GAGTCCCTAGGAGTGAGTTCTGTTTGGAGTCTAGATCTACTATCGGCGGTGAATTTGCTACTCGGACTCTCAAGGTAGAGGGAAGGACCATTAAG
GCTCAGATCTGGGACACGGCTGGACAGGAGAGATATATAGCCATTACGAGTGCATACTATAGGGGTGCTCTTGGAGCTCTTCTGGTATATGATGT
TACAAAACCTATTTCCTTTGAAAATGTGAGCCGGTGGCTAAAGGAACTGAGGGATCATGCAGACTCCCATATTGTAATTATGCTGATTGGAAACA
AGACAGATCTGAACCATCTGCCAGCACTTGCTACAGAGGATGCTCAAAGCTATGCTGAAAGACAACGGCTTTCTTTCATAGAAACATCAGCGTTG
GAGGCAACGAATGTTGAGAAGGCTCTCCAGATGAATCTTTCAGAAATTGATCGGATAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378523] SGN-U569325 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1405 [Download] [View] Facility Assigned ID: TUS23N8.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0340 Quality Trim Threshold: 12.5