EST details — SGN-E378525
| Search information |
| Request: 378525 | Match: SGN-E378525 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C176588 | Clone name: TUS-24-F10 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C176588 is on microarray TOM1 spot ID 1-1-7.2.9.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C27059 [cLEF-42-G6] | Trace: SGN-T60579 | EST: SGN-E247535 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C176588 [TUS-24-F10] | Trace: SGN-T193430 | EST: SGN-E392104 | Direction: 3' | Facility: INRA |
| Clone: SGN-C176588 [TUS-24-F10] | Trace: SGN-T193431 | EST: SGN-E392105 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E378525 | Length: 100 bp (1254 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E378525 [] (trimmed - flagged)
CTAGCACGCTCCAAATCAATGACAATACCTACATCAACCCTGTGCAAAATTGCATAAAAGGGCTTGGGATCCCTAGTTCTAGAACGGCCGCCACC
GCCTA
GCCTA
| Unigenes |
| Current Unigene builds | |||||
| No current unigene builds incorporate this sequence |
| Chromatogram |
| SGN-ID: SGN-T1415 [Download] [View] | Facility Assigned ID: TUS24F10.ab1 |
| Submitter: Koni | Sequencing Facility: Giov. Lab |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
| Problems: | Possibly chimeric (anomalous insert into vector) |
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 0 |
Working
