Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E378535

Search information 
Request: 378535Match: SGN-E378535
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177672Clone name: TUS-27-C14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177672 is on microarray TOM1 spot ID 1-1-3.3.6.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C47489 [cLEI-16-G23] Trace: SGN-T83341 EST: SGN-E269117 Direction: 5' Facility: TIGR
Clone: SGN-C177672 [TUS-27-C14] Trace: SGN-T182923 EST: SGN-E370548 Direction: 3' Facility: INRA
Clone: SGN-C177672 [TUS-27-C14] Trace: SGN-T182924 EST: SGN-E370549 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378535Length: 673 bp (1105 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378535 [] (trimmed) CTGGTGCGAACAACCTCACCTCCGCCGTCCCTGTCTCTCGGAAATCACGTGCAAAATCCGGCGTTCACTCTTCGTTACCGTCCTCCGACCTCTGG
ACTATCGCGAAATGCCCACTTGAAGATATTGCCCTTTCTGATTGCAAGTCGTATTCGTGTCCCCCTTTTTACTATGCTTATGGTGGGGGGGGGGG
GGGGGGGAAACTTTACAGCGATGAATTATCAATACCCATGTCGTCTCCATCGTTGATTTTGAAGAATTTTACATTTGGGTGTGCTCACAGTGCTC
TCGGTGAACCCATCGGAGTAGCTGGATTTGGCCGGGGGACACTTTCATTGCCGGCGCAACTCGCGAATAACTCCCCGGAAATCGGAAATTACTTC
TCTTATTGGTTAGTTTCTCACACTTTTGACACGAATCAAGTTCATCGACCCAGTCCGCTCATTCTCGGCCGATACTCTATCTATGAAAAAATGAA
ACAGATGAAGAATTATTACTCCGATTACGCTTACACCCCAATGCTCAATAACCCGGGGGGGGGGGGGGGGGTACACCCTCCGACTCGAAGGTGTA
TCAATCGGAAAAACAAAAATCCCGGCGCCGGGGAGTTTACGGCGAGTTGACAAAAGAGGAAACGGCGGAATGGTGGTGGATTCCGGTACAACTTT
CACTATGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378535] SGN-U588252 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1457 [Download] [View] Facility Assigned ID: TUS27C14.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0129 Quality Trim Threshold: 20.5