EST details — SGN-E378615

Search information 
Request: 378615Match: SGN-E378615
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182987Clone name: TUS-41-A1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182987 is on microarray TOM1 spot ID 1-1-8.1.3.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C117162 [cTOA-5-F9] Trace: SGN-T124538 EST: SGN-E312246 Direction: 5' Facility: TIGR
Clone: SGN-C182987 [TUS-41-A1] Trace: SGN-T200114 EST: SGN-E398788 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378615Length: 455 bp (1171 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378615 [] (trimmed) AAAAAAAGACAGCATTAATATAAAACTGATTGCGGTCATAACATAAGCTTAGTTGCAATAGGAGATGACAGTCTACTGCATCTATTGCAAACAAA
AGTAATTAACATGCACCCAAACTAAGGGGTGGGATTATTATAAAAAAACAGACGACCTCGACCACAAACTAAAACAAACTGGAGATGCTAACAAG
AGACACTTCAAGCAGAGTTTAGTAGGACCAAATCTCATCTTCCTCTGCTGCAGCATTGTCTTCACTGTAATAGTAATAGCCACCATTATTGGTAT
TGGTATTGGCATTGGCAGTGGCTTCTGCAGTGAAGCAGCAAGACGAAAGGTAAGGCATGTTGTGGAAGGACTGAGCTAAGCTGCTGGTCAAAGAT
CCAAAGGCACACCTTCGCCTTCTCCTTCTCTTGTCCCAGAATTCTCTGCACGGTGCTTGAGAGTCTCGAACATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378615] SGN-U578034 Tomato 200607 Build 2 225 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1752 [Download] [View] Facility Assigned ID: TUS41A1.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0008 Quality Trim Threshold: 20.5