EST details — SGN-E378640

Search information 
Request: 378640Match: SGN-E378640
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185047Clone name: TUS-46-F21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185047 is on microarray TOM1 spot ID 1-1-4.2.11.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72262 [cLER-1-K19] Trace: SGN-T92067 EST: SGN-E280513 Direction: 5' Facility: TIGR
Clone: SGN-C185047 [TUS-46-F21] Trace: SGN-T199033 EST: SGN-E397707 Direction: 3' Facility: INRA
Clone: SGN-C185047 [TUS-46-F21] Trace: SGN-T200099 EST: SGN-E398773 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378640Length: 382 bp (1078 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378640 [] (trimmed) TTAGGCAGCCGGACAGCGAGCCTCCATCACTGGCAGCAGCTCCCGCTGGCGACAATAAGCCGCCAAGAATCAGCAACTCCGGCGAGCAACAGCAG
CAGCGATGCCGGCGAGAACCAGCAACAACAGCTTCCAGCAACTCCGGACAGCAGCCACCCGGCAGCAGGCTCCGGCGAACAACAACAACAGCTCC
GGCGATGTAGTGACTCACCGACATATTCCGCCGATAACATAATNCATCCCAAAACAATCAGCGTGGCTCCCATTCCGGTTTCTGTCATGAGGAGA
TTGTGGCCAGTTGCATGGAAGTCTTGAAATCATTCCTGAAGTGGGTATGTCCTCAAGTCCGAGGATGATGCCTTTGTATAAATCGATCTATGTTT
CA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378640] SGN-U583400 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1862 [Download] [View] Facility Assigned ID: TUS46F21.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0224 Quality Trim Threshold: 12.5