EST details — SGN-E378656

Search information 
Request: 378656Match: SGN-E378656
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185995Clone name: TUS-48-N9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185995 is on microarray TOM1 spot ID 1-1-8.2.7.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C69853 [cLER-12-M6] Trace: SGN-T94374 EST: SGN-E283407 Direction: 5' Facility: TIGR
Clone: SGN-C185995 [TUS-48-N9] Trace: SGN-T192568 EST: SGN-E391242 Direction: 5' Facility: INRA
Clone: SGN-C185995 [TUS-48-N9] Trace: SGN-T192810 EST: SGN-E391484 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378656Length: 347 bp (1012 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378656 [] (trimmed) GATCCCTTGGTCGAAGCGTCTTACTTTTAGGTTGTGGAAAAATGAGGGAGAGTGATTGTGATGTTTTCTCCTCGTCTTTTCTCTCATTTTCTCCT
TTTATCTGATTTTGCACTTTTGTGGTTCTTTTTTTTCTTGGACCCAATAATGTCAATATTTATTGAATGAGAAGATTCCTATATAATATCAGTTT
GGGGAAATGGAAATGGATGAATCCCCTGTTGCTGAGAATGGCTGCAAATGTGGATCTGACTGCAAGTGCAACCCTTGCACTTGTTCTACGTGAAC
AAAAATATAGTTGACCCCGAGCAGAGATAATGGTGTTAGCCTTCTATGGCTGACGAAAATAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378656] SGN-U579547 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1920 [Download] [View] Facility Assigned ID: TUS48N9.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.886 Expected Error Rate: 0.0205 Quality Trim Threshold: 20.5