EST details — SGN-E378673

Search information 
Request: 378673Match: SGN-E378673
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175274Clone name: TUS-20-O16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175274 is on microarray TOM1 spot ID 1-1-1.3.13.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C24215 [cLED-7-I23] Trace: SGN-T50321 EST: SGN-E231812 Direction: 5' Facility: TIGR
Clone: SGN-C175274 [TUS-20-O16] Trace: SGN-T189946 EST: SGN-E377735 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378673Length: 980 bp (1207 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378673 [] (trimmed) CAAGATTCATCTTTTCTGATTTTTATTTTTGGGAAATGGAGTTCTTGGAAAGACCTGATGCTCAATTGATTATTGGGGTTGCTGTTGCAGCTGTT
GCTGTTGGTGCTACAGCTTATTTTTACTTCTCTTCCAAGAAGTCCAAAGTATGTTTGAACCCTGAAGAATTCAGGGCATTTAAGCTTGTTAAGCG
CACACAACTTAGCCATAATGTGGCGAAATTTAGATTTGAACTTCCGACGCCCACTTCTGTGTTGGGGCTACCCATTGGACAACATATTAGTTGCA
GGGGCAAAGATAGTCAAGGTGAAGAGGTTGTTAAACCATACACACCAACTACTTTGGACTCTGACATTGGATACTTTGAGTTAGTTATAAAGATG
TATCCCCAAGGAAGGATGTCACATCATTTCCGGGAAATGCGCGAGGGTGATTACATGGAAGTGAAGGGACCCAAGGGGCGCTTTAAGTACCATCC
TGGTCAAGTTAGAGCATTTGGAATGCTTGCAGGAGGCTCTGGCATTACCCCGATGTTCCAGGTTGCTAGAGCTATTCTTGAAAATCCCAACGACG
TGACGAAGGTGCACCTGATATATGCTAATGTTACTTCTGAAGATATTCTTCTGAAGGAAGAGTTGGAGGGCCTTACTGTTAACTATCCTGACCGT
TTCAAAGTTTATTACGTCTTGAATCAGCCTCCTGAAGAATGGAGTGGTGGTGTGGGATTTGTCTCCAAAGAAATGATCCAAGCTCATTGCCCTGC
CCCGGCAGATGATATTAAGATACTGAGGTGTGGTCCACCACCGATGAAACAGGCATGGCTGCTCATCTTGAAGCCCTCGGATACTCACCGGAGAT
GCAATTCCATTCTAAACTGTTTTTTCTTGGTTTCCATCTTATCCCCGCGTTGAAATTATTGCGAAATATAGTCTGGAGAAGACATATTGACATTG
TCATTTTTCAGTGAGAGACTCATAAACCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378673] SGN-U583893 Tomato 200607 Build 2 45 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1360 [Download] [View] Facility Assigned ID: TUS20O16.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0090 Quality Trim Threshold: 14.5