EST details — SGN-E378703

Search information 
Request: 378703Match: SGN-E378703
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179902Clone name: TUS-32-P12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179902 is on microarray TOM1 spot ID 1-1-5.4.1.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C86886 [cLET-44-J24] Trace: SGN-T111516 EST: SGN-E298880 Direction: 5' Facility: TIGR
Clone: SGN-C179902 [TUS-32-P12] Trace: SGN-T186354 EST: SGN-E372873 Direction: 3' Facility: INRA
Clone: SGN-C179902 [TUS-32-P12] Trace: SGN-T186355 EST: SGN-E372874 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378703Length: 771 bp (1166 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378703 [] (trimmed) TTGGAATGAACTTTTGGATAAAGGTCTTTTGAAAGGACATGTAAGTGAAACATTAGTGGGGTCTTGGTGTGAGAAGGGAGAAATTTCGGCATTGT
TGGCATCACTCAATGAAATAGGAGCGCAAGGTTTTGTACCTAGTCTTGCTATGTGCAGTACTTTAGCCCACGGATTAAATCAAGCAGGATATTCT
GAAATATTACCTATGTTTGTGGAGACCATGGTAAAGTTTTCCTGGATCTCCAATTCCATGACTTCAAATGACTTAATCAGACATTGTCAGATAGA
TGAACATACTGAAAGTATTAGCAACACTCCGAAGCAATCTGCCTTATAAGTTGCTTGTCAGCTTCAAGACTAGCTCAACAAGAACGTTGTATGCT
GGATCGATACATTCTTTCTGCGGTTTTTGACCATGGATGCTTGATGGCAAACCCAGACTCCACTTGTGGGACCACACTAGCTTACATGTGAAGAT
AAGTGAAGTTCTTCGGTTCTATGGTCACTCGTTTTATGTCATCCTTATCACGGTGTTTTCTCCTCGGACTATTGAGGAAAAACAAGGCACGGAAA
CCTTGATGTGCACATTTGAGTTAGTGGTTCTTGGAGAAGGAGTTTTTACGTGTAGTTTTCAACCCCTCTGATGCACTTGTGAAGTTACCTTGAAC
CTAGGATGGATGTGTCTTGTAAGCTGTGGATCTATGTCTCACTATCTAATGATATTTATATTCGTTTTGTAAACTTTAATATCATGTATTGGGGC
TCACATTGTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378703] SGN-U582923 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1568 [Download] [View] Facility Assigned ID: TUS32P12.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0040 Quality Trim Threshold: 14.5