EST details — SGN-E378734

Search information 
Request: 378734Match: SGN-E378734
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184524Clone name: TUS-45-A2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184524 is on microarray TOM1 spot ID 1-1-7.1.14.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81546 [cLET-17-B4] Trace: SGN-T107024 EST: SGN-E294969 Direction: 5' Facility: TIGR
Clone: SGN-C184524 [TUS-45-A2] Trace: SGN-T198601 EST: SGN-E397275 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378734Length: 428 bp (1238 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378734 [] (trimmed) CATCTTGCAAGTTTGAGAAACGTCTAGTCTAGAGAGAAATGGCAAATCCAAAGGTTTTCTTTGACCTTACCATCGGTGGTGCACCAGCTGGTCGT
GTGGTGATGGAGCTCTTCGCCGATACCACTCCCAAAACCGCTGAGAACTTCCGAGCTCTTTGTACCGGTGAGAAAGGTGTTGGAAAGATGGGGAA
GCCTTTGCACTACAAGGGCTCAACCTTCCACCGTGTGATCCCAGGGTTCATGTGTCAAGGAGGTGATTTCACCGCCGGAAACGGGACCGGAGGAG
AGTCGATCTATGGAGCCAAATTCAACGATGAGAACTTCGTTAAGAAGCACACCGGCCCTGGAATCCTCTCCATGGCTAATGCTGGACCTGGAACC
AAACGTTCTCAGTTTTTCATCTGTACCGCTAAGACTGAGTGGCTCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378734] SGN-U577630 Tomato 200607 Build 2 444 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1832 [Download] [View] Facility Assigned ID: TUS45A2.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.988 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5