EST details — SGN-E378753

Search information 
Request: 378753Match: SGN-E378753
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175541Clone name: TUS-21-J19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175541 is on microarray TOM1 spot ID 1-1-6.2.13.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C15446 [cLED-11-P13] Trace: SGN-T51552 EST: SGN-E235542 Direction: 5' Facility: TIGR
Clone: SGN-C175541 [TUS-21-J19] Trace: SGN-T190603 EST: SGN-E377841 Direction: 3' Facility: INRA
Clone: SGN-C175541 [TUS-21-J19] Trace: SGN-T190604 EST: SGN-E377842 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378753Length: 889 bp (1261 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378753 [] (trimmed) TTTCCAGGTAACTTAAGCTAATTACAAGATTATATCGTTCCATTTTCTCAAGTGTTTTTTTTAATGGGAAGAGAAATAGTGAAAGCAGAATCAGT
TGAGGAAACAAGCTTCAACTGGTCATCAGCATCATCAGATTCATCATCCACAACATCTTCTTATGATGAAGAAAACAGAATGCCTCTGTTAGCAT
TGAATCATGTTTCTTATGTCTGCAAATCTGTTCCTAAATCTGCCCAATTTTATGAACAAGTCCTCGGTTTCGTACTAATCAAACGTCCATCCTCC
TTTGATTTTGATGGTGCTTGGTTATTCAACCATGGAATTGGAATTCATTTGTTAGGAAAAGAAGATGTGCAATCAAAAAGGGGAAAAATTAACCC
AAAAGATAATCACATTTCATTTCAGTGCACAGATATGGATCTTATTATTCAGAGATTGAATGATATGAATGTTGAATATGTAACTGCTACTGTTA
AAGAAGGTGGAGTTACAGTGGATCAACTCTTTTTTCATGACCCAGATGGCAATATGATTGAAATTTGCAATTGTCAGAATTTACCTGTTCTTCCA
CTTTCTTCTTGCCCACTCAAAAAAATGTCAAGTCCAACTTTCAACCAAACAATGTCAGATTCCTTTTATGGAAATGGAAAAACAAATACAAAGAT
GAATTGTTCAGGAGAAGTTGAATCTCTTATGATGGAAAATTTAGCTTTGGATATGATGGACATTTCTTTTTGAGTGATTCATGTGGAAGAAAAAG
AAAAGTGAATTTTGCTCATCATTATTAGCTCTTTTATTTATTTTTTTACCAACCCAATATAACATAAAAAATCCTTTTTGTAATATTATTATTAT
TATGAATTAGAAGGAAGTGAAGAGAGGGGTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378753] SGN-U573554 Tomato 200607 Build 2 74 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1374 [Download] [View] Facility Assigned ID: TUS21J19.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0118 Quality Trim Threshold: 12.5