Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E378763

Search information 
Request: 378763Match: SGN-E378763
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178390Clone name: TUS-29-A12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178390 is on microarray TOM1 spot ID 1-1-5.1.4.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C65289 [cLEM-8-O10] Trace: SGN-T85384 EST: SGN-E271833 Direction: 5' Facility: TIGR
Clone: SGN-C178390 [TUS-29-A12] Trace: SGN-T183882 EST: SGN-E371553 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378763Length: 963 bp (1238 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E378763 [] (trimmed) GAACGAGGCTTCATTCCACCGATCCAGATCTCAAATCTCCGAGAGAGTGAAGAAGACGAAGAAGAAAATTGATTAGTAATGGCGGCCGTATCGCC
ATTAGCAAAGTATAAGCTTGTGTTTTTGGGCGATCAATCTGTTGGAAAAACCAGCATCATTACTCGCTTCATGTACGATAAATTCGATACCACCT
ACCAGGCTACCATTGGTATCGATTTTTTGTCCAAGACAATGTACCTTGAAGATCGTACAGTTCGCTTGCAGCTCTGGGATACTGCTGGTCAAGAG
AGATTTAGGAGTCTTATTCCCAGCTACATTAGAGATTCTTCTGTCGCTGTAATTGTGTTTGATGTTGCCAACCGTCAATCATTTCTAAACACTTC
AAAGTGGATTGAGGAAGTACGTACTGAACGGGGAACTGATGTCATAATCGTTCTTGTTGGGAACAAAACTGATCTTGTTGAGAAAAGGCAAGTAT
CCATCGAAGAAGGTGAATCCAAGGCTCGCGAGTTTAATGTAATGTTTATAGAAACTAGTGCTAAAGCAGGATTCAATATCAAGCCTCTGTTCCGA
AAGATTGCTGCTGCTTTACCTGGAATGGAAGCCCTTTCGTCCACGAAGCAAGAAGATATGGTGGATGTGAATTTGAAGCCTACCACAAGTTCATC
TAACGCAGAGCAGCAAGGTGGAGGTTGTGCATGCTAGATTTTGTACGTAACAAGAGAGAGATAACAAGTTGGACATACACAAAGATGCAGTTGCA
TCAAATTATATCATAATATATATAGATGTTCAATTAGCTCATTTTGTTAGATCATTATGAGTTTTGGAACANTTTTGGGTTTTTATTCATGTTGT
ACAACAGTTCTTTTCATTCTGATGGTGAGGTAGCTGACACTCTGTTGTTACTATGAAAACTTGTGATATATATTATGTGATGTGATCCTAGTTCA
GGAATCTTTCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378763] SGN-U579137 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1482 [Download] [View] Facility Assigned ID: TUS29A12.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5