EST details — SGN-E378803

Search information 
Request: 378803Match: SGN-E378803
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183474Clone name: TUS-42-E8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183474 is on microarray TOM1 spot ID 1-1-1.1.2.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C34371 [cLEG-30-K9] Trace: SGN-T69034 EST: SGN-E255308 Direction: 5' Facility: TIGR
Clone: SGN-C183474 [TUS-42-E8] Trace: SGN-T196016 EST: SGN-E394690 Direction: 5' Facility: INRA
Clone: SGN-C183474 [TUS-42-E8] Trace: SGN-T200287 EST: SGN-E399244 Direction: 5' Facility: INRA
Clone: SGN-C183474 [TUS-42-E8] Trace: SGN-T200454 EST: SGN-E399572 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378803Length: 437 bp (1134 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378803 [] (trimmed) CGATGCTCACCCTATCAGAGCAATTCAGTTTTCTGTCTCACCAGTTGTGCGTGTAGCTGTTCAGTGCAAGGTCGCATCTGACCTTCCCAAGCTTG
TTGAAGGGTTGAAACGTCTGGCTAAGTCTGATCCTATGGTTGTTTGTTCTATTGAAGAGTCTGGAGAGCATATTATTGCTGGTGCTGGAGAACTC
CACCTTGAGATCTGTCTGAAGGATTTGCAGGATGACTTTATGGGCGGTGCTGAAATTATAAAATCTGATCCCGTTGTGTCCTTCCGTGAGACGGT
CCTCGAGAAGTCTACTCGAACTGTGATGAGCAAGTCCCCTAACAAGCATAACCGTTTGTACATGGAGGCTAGACCAATGGAGGAAGGGCTTGCTG
AGGCTATTGACGAGGGACGCATTGGCCCTAGGGATGACCCTAAGGTTCGTTCCAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378803] SGN-U583190 Tomato 200607 Build 2 176 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1764 [Download] [View] Facility Assigned ID: TUS42E8.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0040 Quality Trim Threshold: 20.5