EST details — SGN-E379088

Search information 
Request: 379088Match: SGN-E379088
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167755Clone name: TUS-1-F9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C1011 [cLEC-10-H15] Trace: SGN-T24860 EST: SGN-E201273 Direction: 5' Facility: TIGR
Clone: SGN-C167755 [TUS-1-F9] Trace: SGN-T1159 EST: SGN-E379063 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379088Length: 806 bp (816 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E379088 [] (trimmed) TTCTATTGAGACTTCGGAGATCAATGTTTCAAATACAAGGAAACTACCACTAAAAACAATTCCTAAAAATTATGGAGGTGTAACTGGCATTTGTC
TAAGATACAACAACTATATTAAGTTCTTTCCACTTGTCTGAGGAAAAAGGGTCATCATTATTGCTCTAGCAATTGGCAGAAGTCCTACAATAGCA
ATCAATAGTTGATCTGAGGTGCTTGTCCTAACTGTGATTTGCCCGCTTTTCTTGCTGTTTAATCCGGCCCTAACAGCAATCTTGGAATTCCTTCC
AACAGAGAACTGAGATTGCAGATTGCATCCCCATATGAGATCGTTTCTCCATTTCATCAAAGAAAGGCCGAGTGAACTTTGGTCCTGTCCAACAG
GGTAATCTTTCTCTCTCAGACGCAACTCTAAGTTGGCTCCATATGCTGCATTACCCTGAGACATGATGGTGCCAGTACTTCCCACCACAACTAAC
TGTTTACCAATGGAAAATTGGTCCTCCAATTTCAATCCCGTCACTAAAGTGTCACCCAAGAAAGTAATGGATATCCCTGCAGCTGTTTTATTCGT
TTTCAGATTTTTCACTTTTGTTTCTCCCTTCAAAATGTAGGCAAGTTGCTTTCCTACAGTTTGAATGTCGAACCCTACCATACTTGATCCTTTCT
TCCCCGTCTTTGCTGAAACAGATGAATCCNAGTGGATGTTGAACTCTTTCTTGTCCTTTGTGAGCTGAAGAACTATTACTGCAGGAAACTGGCCA
GCNATGGCAAGGTGATCCTCAATGCTCACACCATCATATCCACAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379088] SGN-U570429 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T217 [Download] [View] Facility Assigned ID: 227_F09_TUS01F9.Td_077.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0045 Quality Trim Threshold: 20.5