EST details — SGN-E379089

Search information 
Request: 379089Match: SGN-E379089
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167773Clone name: TUS-1-G3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C8194 [cLEC-4-L10] Trace: SGN-T24503 EST: SGN-E201553 Direction: 5' Facility: TIGR
Clone: SGN-C167773 [TUS-1-G3] Trace: SGN-T1165 EST: SGN-E379064 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379089Length: 752 bp (790 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E379089 [] (trimmed) ATATCACTGCATAGGTTCTCTGATGCCACAGAAATAGGAAAGAAATGTATGTCCACTATACATTTTTCTTCTGAGTTCTTTAGTGATATATGCAT
CTTAACAGACACTTTTAAGTGTCACTAATAGGTATTGCTACAAGCAGTTTGGACCTTCAACTATAAATAGCTTGTCATTATCTCTTATTACTTCA
ATTGAGTCAATTTCTGATCCTTCTTGATCCGTAATCGATGCATTTGTTGCATCAAATCCAAATTTCTGACCTGCAATGATCTTGAGCTCTGCAAG
TGAATTTGGAAGCGTAATTAATTTGCCAGGTTCACTGCAATGAGTTCTTCTCCTGATAACAGGATGGCCTCTGTATATGCTAACTCTAAAAGACA
TTTGATCCCTAGTGCTTTCTGAATTGTGTTGCTTCTCTTGTTGGCGCCATTTTTGAGCAACTTCATCCATTGTGTCGGATACCATAATTCTGTGT
CCTACTTCGCGCTTTTGTAGCATGTCATTTAGGTTCATTGAAGAAAGCTTGTACTTTAACTTATCGTTTATCTCAGCTCCATTCATTAGAAGTAG
CTTTACCATGTCTTCAAGATTTTCTTCCAGTGCAACATGAATAGCAGTTGATCCATCGCGGTCCTTCGAAGTCACTTGTAATCCATGTTTTAGGA
GTTCTTTCATCACTGTTAAGTCATTTTTTCTAGCTGCTGTGCATAAGAGGTCACCAGCAATGTAGGGATCGGAGACGGAAGCCCCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379089] SGN-U568026 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T223 [Download] [View] Facility Assigned ID: 227_G03_TUS01G3.Td_022.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0033 Quality Trim Threshold: 20.5