Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E379193

Search information 
Request: 379193Match: SGN-E379193
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167788Clone name: TUS-1-G18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C8151 [cLEC-4-I19] Trace: SGN-T24404 EST: SGN-E201454 Direction: 5' Facility: TIGR
Clone: SGN-C167788 [TUS-1-G18] Trace: SGN-T1243 EST: SGN-E379759 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E379193Length: 698 bp (801 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E379193 [] (trimmed) GTAATAGAAAAGGCTTGATTCCAGAATAGATTATCATTTCCGCTACTAGAAATAAGGATCTATATGTAAGGCATTTTTCTTAAGGACACTGTACA
TGGTATACTAAAGGACAAAAAACTGAGCCAAGTTTCAAAGTTCAACATGATTTCATCAGCCTATTTTCTCCGGTACATCGGCCCGCGGTGAAAAA
CAAACCATCAGTAGGTCTATGTGAACAGATCAACATATACGGAAGAACGCCTTCGGTTGTATTGGAGCAAGCTTGCATATGTTCGATCCCAGATA
CCGATGTAAAGAGACTCATCGTCTGGACTCAGAGATACACCAGATATCTCGCCAGACATGTCAATTTCTTGACGTTTTCTGTACTCTCCTCCAGC
ATTGTAAATGTGGACAAAATCTGCAGGTTCAGCCACCACCAAGAACCGCCCATCTGATGAGTAACGGATTGATCGGACAGCACCCATGTTTCCTT
TCAGCACTGCTGTTGGCGATGACAGGTTTCTCATGTCCCAAATTCGACAGGTTTTGTCTTGATTCCCAGTGGCAAAGGTACGGCCATCACGGTGC
CAGGCAGACGCGAAAGAATAGTCTAGATGACCAACAATTGAGCCAATCGTCTTTCCGTTTTGAGAATCACAAGGAAGCCAGTGAGATCATCTCCG
ACAACAGTAAGAATCTTGCTATCTGGGCTCATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E379193] SGN-U585692 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T465 [Download] [View] Facility Assigned ID: 230_G06_TUS01G18.Td_040.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0115 Quality Trim Threshold: 20.5